EST details — SGN-E273928

Search information 
Request: 273928Match: SGN-E273928
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C68780Clone name: cLEN-7-L7
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189527 [TUS-58-A13] Trace: SGN-T339543 EST: SGN-E538668 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C189527 [TUS-58-A13] Trace: SGN-T339545 EST: SGN-E538670 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E273928Length: 347 bp (731 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E273928 [] (trimmed) GCAGTGCCAAGACCAATATGGAATGCGGCTTCACAGATTCTGATGGCTGTTGGATACATCTGTTTAGCCATGGCTATGCCAGGATCACTCTACAT
TGGCTCCATTGGGGTTGGAATTTGCTATGGGGTTCGTCTTGCCATATCTGTTCCAGCTGCTTCTGAGCTCTTTGGGCTCAAATATTACCGGCTCA
TGTATAATGTCCTAATTCTCAACCTTCCACTCGACTCATGACTGTTCTCTGGTTTGCTTGCGGGTCTGTTATATGATGCTCAGGCTACAACAACA
GCTGATGGTGGTAACACTTGTGTACGTGCTCACTGCTACAGGCTTGTATTTATAGTTGTGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E273928] SGN-U579611 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T88624 [Download] [View] Facility Assigned ID: TRRBA64TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0268 Quality Trim Threshold: 14.5