EST details — SGN-E275009
| Search information |
| Request: 275009 | Match: SGN-E275009 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C66816 | Clone name: cLEN-16-B9 |
| ||
| Library Name: cLEN | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: fruit pericarp
Development Stage: red ripe to over-ripe
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E275009 | Length: 174 bp (979 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E275009 [] (trimmed)
ACCTTGGGAAGAAAAACTGTTGGAACGTGCAAGAGCTCTGTTGGTCAATGCTGGAACAGAACCTGATGCAGATCTTGGTCCAGTAATTAGCAAGC
AGGCAAAAGAACGAGTATGTCGATTGGTTCAAAGCGGCGTTGATAGTGGAGCCAAATTATTGCTTGACGGAAGAGATAT
AGGCAAAAGAACGAGTATGTCGATTGGTTCAAAGCGGCGTTGATAGTGGAGCCAAATTATTGCTTGACGGAAGAGATAT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E275009] | SGN-U567272 | Tomato 200607 | Build 2 | 30 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T90732 [Download] [View] | Facility Assigned ID: TRRCK05TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.942 | Expected Error Rate: 0.0174 | Quality Trim Threshold: 14.5 |
Working
