EST details — SGN-E27518

Search information 
Request: 27518Match: SGN-E27518
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C14441Clone name: cLEC-7-O8
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172993 is on microarray TOM1: SGN-S1-1-2.4.20.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C14441 [cLEC-7-O8] Trace: SGN-T25282 EST: SGN-E202000 Direction: 5' Facility: TIGR
Clone: SGN-C172993 [TUS-14-P15] Trace: SGN-T196626 EST: SGN-E395300 Direction: 5' Facility: INRA
Clone: SGN-C172993 [TUS-14-P15] Trace: SGN-T199753 EST: SGN-E398427 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E27518Length: 379 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E27518 [] (called/trimmed by facility)
TTTTTTTTAAGCTGATTAAAAAGAAAAAGGTGTTTAATAAATTGAATAAATGGAATACCTCTTGAAATAAGTTGATTTTGATAGTTTCGCCTCAA
AGAGGCCTAGTGGATGATGCACTAGTTGATAATTAACGGTGTAAAAAAGTATATTTACATAATTAAATCAGTAAATTTCTTAATAAATAAATATC
GATGGATCGGGTCCTATGTGGGGGTGTTTGGGACCATGGTCCTGACCACCTTAGCTGGGTGGTTAATGCCAGTTGCTGTCTTAGTACTAGTATGC
TTATTTAAAAAGTACATAATCCTTCTGAAAAAACATGTCAAACGTGAAAATAATGTAATATTTGNACATTTTTTCCATCTAACTGACTTTCGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T25282 [Download] [View] Facility Assigned ID: TCAAZ88TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence