EST details — SGN-E275379

Search information 
Request: 275379Match: SGN-E275379
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C65473Clone name: cLEN-10-E18
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: Alias clone SGN-C183379 is on microarray TOM1: SGN-S1-1-8.1.1.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183379 [TUS-42-A9] Trace: SGN-T195471 EST: SGN-E394145 Direction: 5' Facility: INRA
Clone: SGN-C183379 [TUS-42-A9] Trace: SGN-T195938 EST: SGN-E394612 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E275379Length: 443 bp (879 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E275379 [] (trimmed) GCATTCTCCATTCTTGGAAGTGGCCATTCTTGATTTCTTGAAACAAAGAAATTCAGAGTGGCCATTGTTGAAAGAGAGGGTGGAATTTGTAAGTC
AAGAAACAGGTTACTCCTGTTTGAGTGAGGAAAAGTTGGTTTGCCTGTCTGTGGTCTTTTTATAATCTTTTTCTACAGAAGAGAAAGTGGGTAAT
TTTGTTTGAGAGTGGAAATATTCTCTAGTGGGAATCTACTAGGAGTAATTTATTTTCTATAAACTAAGTAAAGTTTGGAAGGTGACAAAAAGAAA
GACAAAAATCTTGGAATTGTTTTAGACAACCAAGGTTTTCTTGCTCAGAATGTCTGTTGCCTTGTTATGGGTTGTTTCTCCTTGTGACGTCTCAA
ATGGGACAAGTTTCATGGAATCAGTCCGGGAGGGAAACCGTTTTTTTGATTCATCGAGGCATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E275379] SGN-U580527 Tomato 200607 Build 2 240 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T89251 [Download] [View] Facility Assigned ID: TRRBL33TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.932 Expected Error Rate: 0.0016 Quality Trim Threshold: 14.5