EST details — SGN-E276300

Search information 
Request: 276300Match: SGN-E276300
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C67885Clone name: cLEN-21-O8
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: Alias clone SGN-C183077 is on microarray TOM1: SGN-S1-1-6.4.3.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183077 [TUS-41-D19] Trace: SGN-T195174 EST: SGN-E393848 Direction: 5' Facility: INRA
Clone: SGN-C183077 [TUS-41-D19] Trace: SGN-T195813 EST: SGN-E394487 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E276300Length: 650 bp (905 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E276300 [] (trimmed) GAAGAGTTGTTCTACTTGAGTGACAAACAAGGACTATCAGCAAATCATGAACCAACAACTTACAATGTCTTCTTCCAATTCGGATCATCAACAAC
TTACAATTTCTTTTCCGGAAGAATCTGATACAACTTTTGTGGGAGACCTAGGGCTAGCGTTAACAACTATGAGCAGGAATCAGTCTAATCAAATG
CAAGTAGCTCTTCAACAATTCAAGTTAGTTTCTCAAAGTTTGAGTACTAGGAAGAGTTATGCCAACCAAATACTCCAGGTGCCGATGACCCCCCA
AAAAGGAGGGACTTTCTGAACTAGAGGAACAAAAGATAGCAAGGAGCTATTTCGACACAAAGATACAACATGCACAATTGGTTTCAGATGCCTAT
AATGCCAGCCATGGATTTGATTGTGAGATAAGGAGAGGAAAATTGATGCCTCCTGCTGCTGCTGGTTCAGAAAAAAGGATTAAGAAAATCAAAGC
TGCTTCAGAAAAAGTTGGTGCCTGGATCAAAGAGGATGAAATCATAATCTTAAAGGGACTCATAAAGTTGAAAACTGAAAAAGGGAAAATTAGTT
TAGATTATGTTCAACTTTATGATTCCATTAAACAATCTCTTGCTCACAAATCAGCCACACCACTTCATTTGCAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E276300] SGN-U564829 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T91559 [Download] [View] Facility Assigned ID: TRRDD88TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0050 Quality Trim Threshold: 14.5