EST details — SGN-E276484

Search information 
Request: 276484Match: SGN-E276484
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C67212Clone name: cLEN-17-N16
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: Alias clone SGN-C183019 is on microarray TOM1: SGN-S1-1-8.2.3.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183019 [TUS-41-B9] Trace: SGN-T195164 EST: SGN-E393838 Direction: 5' Facility: INRA
Clone: SGN-C183019 [TUS-41-B9] Trace: SGN-T195808 EST: SGN-E394482 Direction: 3' Facility: INRA
Clone: SGN-C183019 [TUS-41-B9] Trace: SGN-T195808 EST: SGN-E398838 Direction: 3' Facility: INRA
Clone: SGN-C183019 [TUS-41-B9] Trace: SGN-T200139 EST: SGN-E398839 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E276484Length: 617 bp (894 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E276484 [] (trimmed) GAAAAACAATCGTTTAATGGCAAATCCGTTGCGATTGTATCTGACATGCATAAGAAATACGCTTGAGGCAGCAATGTGTCTTCAGAATTTCCCAT
GCCAAGAAGTAGAGAGGCATAACAAACCAGAGGTTGAATTAAAGTATGACTTCATGCTGCTGTCTCATTTTACTCGAAGTTAATGATGTCGGTTA
GCATTACATAATTTTTCTCTTCTGTAATTCATCAAATGTCTTCACAGCGTGTGGATTCCTATAATCAAGAAGAATTTCATGTGTATTCTTTTTAC
ATATAGTATGACTGGATCCTAAAACATTAACTTTTGACTTGCATACACATATCACTTTCTGCAGCAGAACTTAATATTTTACTAAAATGCTATTG
TTGAGTTCTCATCTCTTTACGCAGAGAAACTTATACTGAATGCTTTTTATGGGTTAGAGGAATCGACGTGCAGCATTGATAAAATAAGAAAAATC
TTACAACACACGTTGACTCATTGCTCCCTTTTATTTGTTACCTGCAAAGTGTGTAGATCAGAATAATAATGTTTTTCTCATTTGGTATGTTCTAC
AGGACAAGCCCAGAACTTCTTCTTAATCCTATTACGATTTGTAGAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E276484] SGN-U576050 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T90905 [Download] [View] Facility Assigned ID: TRRCP80TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0024 Quality Trim Threshold: 14.5