EST details — SGN-E276803

Search information 
Request: 276803Match: SGN-E276803
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C66410Clone name: cLEN-14-C20
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: Alias clone SGN-C180955 is on microarray TOM1: SGN-S1-1-8.4.17.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180955 [TUS-35-L9] Trace: SGN-T196411 EST: SGN-E395085 Direction: 5' Facility: INRA
Clone: SGN-C180955 [TUS-35-L9] Trace: SGN-T197721 EST: SGN-E396395 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E276803Length: 681 bp (796 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E276803 [] (trimmed) ATTAACTCGAGTCAGCCACCCGAATAAGGCAATCATGAGCGCTGTGAATGTTACAAACATCACCGTGCTAAATAATCCGTCATCGTTCCTTTCGC
CACTGAAGTTTGAAATCACTTATGACTGCGTTAATGCTCTCAAAGAAGATTTGGAATGGAAACTCATCTATGTTGGATCTGCTGAGGATGACACG
TATGACCAATTACTAGAAAGTGTGTTTGTTGGTCCTGTCAATGTTGGAGGTTTCCGCTTTGTATTGCAGGCGGACCCTCCAGATCCTGCCAAAAT
TCGTGCTGAAGATATACTTGGTGTCACTGTGCTCCTTTTGACCTGTTCCTATGTGGGTCAAGAGTTTGTACGAATTGGCTACTATGTGAACAATG
ATTACAATGATGAGAATTTGAGACAACAACCTTCCCAAATGGTTAAAATTGACATGCTTCAAAGGAACATACTAACAGACAAACCTAGAGTAACA
AAGTTCCCTATCAATTTTCACCCCGAAAACAGCGAGACTGGAGAGCAAGCCGCTGCCCCTCCACCTGATGATAATACGGCTGAAGCAGATGGTTA
TGAAGAGTGACTACCTTCAACTAGGAATGGATCAGATGAGGGTGGGGCCTAACTGTGGAAGGATGTTAATCTTTTGCGCAACTCCTAACCTTTTA
GTTTGACATCGTTCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E276803] SGN-U571097 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T90349 [Download] [View] Facility Assigned ID: TRRCB22TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.984 Expected Error Rate: 0.0037 Quality Trim Threshold: 14.5