EST details — SGN-E278225

Search information 
Request: 278225Match: SGN-E278225
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C74446Clone name: cLER-9-I17
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189822 [TUS-58-M20] Trace: SGN-T340052 EST: SGN-E539177 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C189822 [TUS-58-M20] Trace: SGN-T349052 EST: SGN-E548177 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E278225Length: 433 bp (750 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E278225 [] (trimmed) GTTCTTGTTCCAGACACGACTACCATGGTTATTATGCTGCCAATTTGTGCAGCAGCAGAAGAAGTGGAATTTGGGAAGATTATTCATGATTTAGC
TGTAAAGCTAGGATTATCTGACGAGTTAACAGTGAATAATTCTTTAGTGGATATGTATTGCAAAGTTGGATACCTTTCTGATGCACAAATTCTGT
TTGAGAAAAATGAGAGCAAAAGTGCGGTCTCTTGGAACTCCATTATCGGGGGTTATTCAAGAGAAGGAGATGATAGAGGAACATTTCATCTTATG
AGAAGGATGCAAAGTACTGAGGAGTACATGAAGGCGAATGAGGTTACTCTACTGAATGTTTTGTCCGTTTGCCTAGAGGAGTCAGAGCAGTTGAT
AGTGAAAGAACTGCATGGCTACTCACTTAGAAATGGTCTTGAATACCATGAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E278225] SGN-U604389 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T93959 [Download] [View] Facility Assigned ID: TPRBG57TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0067 Quality Trim Threshold: 14.5