EST details — SGN-E278398

Search information 
Request: 278398Match: SGN-E278398
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C56606Clone name: cLEL-2-F16
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C56606 [cLEL-2-F16] Trace: SGN-T21180 EST: SGN-E278543 Direction: 5' Facility: Novartis
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E278398Length: 364 bp (1173 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E278398 [] (trimmed) CGACACTAGTCCATCCAAAGCTTCTGAAATCACCGGAAATGGGAGAGTCACCATGAGGAAGACTGCTACCAAGGCCAAGCCAGCCTCCTCTGGTA
GCCCATGGTACGGTCCTGACCGTGTTAAGTACTTGGGACCATTCTCTGGGGAATCCCCAAGCTACTTGACCGGTGAGTTTCCTGGTGATTACGGA
TGGGACACTGCTGGACTTTCAGCTGACCCTGAAACATTCGCTAAGAACCGTGAGTTGGAGGTTATTCATTGTAGATGGGCCATGCTTGGTGCTCT
TGGATGTGTATTCCCCGAGCTTTTGGCCCGTAATGGTGTTAAATTCGGTGAAGCTGTATGGGTCAAGGCTGGATCACAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E278398] SGN-U579181 Tomato 200607 Build 2 140 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T21179 [Download] [View] Facility Assigned ID: tomato020432.t3
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0024 Quality Trim Threshold: 14.5