EST details — SGN-E278874
| Search information |
| Request: 278874 | Match: SGN-E278874 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C72731 | Clone name: cLER-2-A21 |
| ||
| Library Name: cLER | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: leaf
Development Stage: 4 weeks
Microarray: Alias clone SGN-C185920 is on microarray TOM1: SGN-S1-1-3.3.7.6
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E278874 | Length: 185 bp (851 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E278874 [] (trimmed)
GAACTTTGTCATTCGACCGGAAAACGATGACAGGGAACAGAGTTACCTATGGCAGAGCTTTGATTATCCAACAAACACTTTATTACCTGGGATGA
AACTTGGGTGGGATTCAAAATCCGGGATGAATAGAAACATAACATCATGGAAATCAGCAATTGACCCAGCTCCCGGAGTCAAGTAGTTGG
AACTTGGGTGGGATTCAAAATCCGGGATGAATAGAAACATAACATCATGGAAATCAGCAATTGACCCAGCTCCCGGAGTCAAGTAGTTGG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E278874] | SGN-U577144 | Tomato 200607 | Build 2 | 3 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T92592 [Download] [View] | Facility Assigned ID: TPRAE11TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.957 | Expected Error Rate: 0.0001 | Quality Trim Threshold: 12.5 |
Working
