EST details — SGN-E279173

Search information 
Request: 279173Match: SGN-E279173
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C58887Clone name: cLEL-4-B18
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C58887 [cLEL-4-B18] Trace: SGN-T16224 EST: SGN-E229318 Direction: 3' Facility: Cereon
Clone: SGN-C58887 [cLEL-4-B18] Trace: SGN-T16603 EST: SGN-E229697 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E279173Length: 85 bp (774 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E279173 [] (trimmed - flagged) ATTCGGACGAGGTTTACAGTTTTCCTAAACGGAACTCTACCATCTCTTTTTTCCGTTACCGTTTAGGTTTCCGACCAATTTTCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T21721 [Download] [View] Facility Assigned ID: tomato040409.t3
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Problems: Too short after trimming low-quality bases
Sequence Entropy: 0.818 Expected Error Rate: 0.0060 Quality Trim Threshold: 20.5