EST details — SGN-E280088

Search information 
Request: 280088Match: SGN-E280088
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C60192Clone name: cLEL-7-H22
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C60192 [cLEL-7-H22] Trace: SGN-T18510 EST: SGN-E237146 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280088Length: 53 bp (1272 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E280088 [] (trimmed - flagged) TCGACACTAGTGGATCCAAAGAATTCGGCACGAGATAATTCTGGTTTTGTATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T22570 [Download] [View] Facility Assigned ID: tomato070447.t3
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Problems: Too short after trimming low-quality bases
Sequence Entropy: 0.806 Expected Error Rate: 0.0345 Quality Trim Threshold: 14.5