EST details — SGN-E280159

Search information 
Request: 280159Match: SGN-E280159
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C60122Clone name: cLEL-7-E24
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C60122 [cLEL-7-E24] Trace: SGN-T18283 EST: SGN-E236919 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280159Length: 378 bp (1036 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E280159 [] (trimmed) ATTAGCTAGAGCAGTTGGTGCTGTAGCGAAACTGATTGCGGGAGAGGGGAAATCGGCCACATCCAAATTACCTTCTGGGGAGGTCCGTTTGATAT
CCAAAAACTGCTCAGCAACAGTCGGACAAGTGGGGAATGTTGGGGTGAACCAGAAAAGTTTGGGTAGAGCCGGATCTAAGCGTTGGCTAGGTAAG
CGTCCTGTAGTAAGAGGAGTAGTTATGAACCCTGTAGACCATCCCCATGGGGGTGGTGAAGGGAGAGCCCCAATTGGTAGAAAAAAACCCACAAC
CCCTTGGGGTTATCCTGCACTTGGAAGAAGAAGTAGAAAAAGGAATAAATATAGTGATAATTTGATTCTTCGTCGCCGTAGTAAATAGGAGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280159] SGN-U573617 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T22425 [Download] [View] Facility Assigned ID: tomato070236.t3
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0148 Quality Trim Threshold: 12.5