EST details — SGN-E280199

Search information 
Request: 280199Match: SGN-E280199
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C60095Clone name: cLEL-7-D21
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C60095 [cLEL-7-D21] Trace: SGN-T18152 EST: SGN-E236788 Direction: 3' Facility: Cereon
Clone: SGN-C60095 [cLEL-7-D21] Trace: SGN-T18270 EST: SGN-E236906 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280199Length: 200 bp (847 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E280199 [] (trimmed) AAACAAATTCAGCTGAGAAGAAAAACAAATTAGTTACAGAAATGACGAATTGGATCACGCTTCATCTTAGTGCGAACCACTGATCCCATGCATCA
CTCTCCTCTTTCCACGTGTCATCCTCTGACGTCAGACCAGATTCCTTTCCCTTTTTTTTTTTTTAAATATATGTGACCTTTTTAGCAAGTACTGC
GTGCCCAATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280199] SGN-U578969 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T22488 [Download] [View] Facility Assigned ID: tomato070323.t3
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0396 Quality Trim Threshold: 14.5