EST details — SGN-E280339

Search information 
Request: 280339Match: SGN-E280339
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72360Clone name: cLER-1-O9
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178680 is on microarray TOM1: SGN-S1-1-3.1.4.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72360 [cLER-1-O9] Trace: SGN-T91894 EST: SGN-E280340 Direction: 3' Facility: TIGR
Clone: SGN-C178680 [TUS-29-M14] Trace: SGN-T184014 EST: SGN-E371685 Direction: 3' Facility: INRA
Clone: SGN-C178680 [TUS-29-M14] Trace: SGN-T184015 EST: SGN-E371686 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280339Length: 311 bp (858 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280339 [] (trimmed) CTGCTGTTGCCACCCGCGGCAATGGTGCACAAGCTAGCATGGTTGCACCCTTCACTGGACTCAAGTCCACTGCTTCTTTCCCTGTTTCAAGGAAG
CAAAACCTTGACATTACCTCCATTGCTAGCAACGGTGGAAGAGTCAGTTGCATGCAAGTGTGGCCACCAATTAACATGAAGAAGTACGAGACTCT
GTCGTACCTTCCTGATTTGTCCGACGAGCAATTGCTCAGCGAAATTGAGTACCTATTGAAAAATGGATGGGTTCCTTGCTTGGAATTCGAGACTG
AGCACGGATTTGTGTACCGTGAGAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280339] SGN-U578438 Tomato 200607 Build 2 819 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T91893 [Download] [View] Facility Assigned ID: TPRAA89TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0326 Quality Trim Threshold: 14.5