EST details — SGN-E280345

Search information 
Request: 280345Match: SGN-E280345
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72048Clone name: cLER-1-A12
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178420 is on microarray TOM1: SGN-S1-1-7.2.4.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178420 [TUS-29-B18] Trace: SGN-T184252 EST: SGN-E371485 Direction: 3' Facility: INRA
Clone: SGN-C178420 [TUS-29-B18] Trace: SGN-T184253 EST: SGN-E371486 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280345Length: 591 bp (970 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280345 [] (trimmed) CTCTATTTGAAGAGCTACTTACTTTCCATACACTTAGTTCAGATCTCGAGATGATGAAAGTAGTGCTGAAGTTGGAGTATGTGGATGAAAAAGTC
AAGCAAAAGGTGATGAAAAAAGTTTCTGTTGTGGAAGGGGTAGAGTCAATGTCGATGGATACAAAGGACAAGAAATTGACAGTAGTCGGAAATGT
AGATCCAGTTGTAATAGTTTCAAAATTGAAGAAACTGTGTCACACTGAGATAGTATTGGTTGGACCAGCAAAAGAGCCGGAGAAGAAGAAAGATA
ATGAGCCGAAGAAAACAGAAGACAAAAAGAAAGCGGCAGCGATAAAGGCATATCCAGCTCCAGTTCTCTATCAATATCAATATCAACAACCTTAT
CCACAGTACCCAACCCCTGTTCCTGCTTATCAGCACTATTACAGTGTGGAAGAGGACTCTAACTCTTGTGTGATCTGCTAGCTTCACATTTGTGA
TGAGTTAGTGGACTAGTTCATACAAGCCTCCTTGTTGTACTATATTTGGTTGAAGAATTGAAATTTAAAGAGGATAATAAGCATTTGAAGCTGAA
AAAAATAAAAAGTTAGATTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280345] SGN-U572795 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T91899 [Download] [View] Facility Assigned ID: TPRAB06TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0026 Quality Trim Threshold: 12.5