EST details — SGN-E280438

Search information 
Request: 280438Match: SGN-E280438
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72249Clone name: cLER-1-J6
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178590 is on microarray TOM1: SGN-S1-1-5.1.3.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178590 [TUS-29-I20] Trace: SGN-T184001 EST: SGN-E371672 Direction: 3' Facility: INRA
Clone: SGN-C178590 [TUS-29-I20] Trace: SGN-T184002 EST: SGN-E371673 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280438Length: 336 bp (799 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280438 [] (trimmed) CAAGTTTTTAGCATTTGGTTTAGCTAGATTCAAGCGAAAATGAGCCGCTTCAGGAGATTTGACATCATCGACTACTCTTCTTCTCCTTCATTTTT
CACCCCCAAAACCCTACTTCTAAACCCATACTTCCACATTGAAGATGAGCTTGACTGCACTCTCGATCTCATCTGCCCTAAGCCTTATGCACCCA
ATACCTTCCTCGATCTAGAAAATTTCGATTCCATTACCGATCTGATCCAAATCGAAACAACCCCTTTTTACAGCACTACTCGCCGGGTCCAGCAC
CGGATAGGACTCGGTACTGAGTTGCAATGTCTCTCTGACCGAGTCACCGCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280438] SGN-U585337 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T91992 [Download] [View] Facility Assigned ID: TPRAD51TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0005 Quality Trim Threshold: 12.5