EST details — SGN-E280481

Search information 
Request: 280481Match: SGN-E280481
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72131Clone name: cLER-1-E11
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178496 is on microarray TOM1: SGN-S1-1-3.1.3.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72131 [cLER-1-E11] Trace: SGN-T92034 EST: SGN-E280480 Direction: 5' Facility: TIGR
Clone: SGN-C178496 [TUS-29-E22] Trace: SGN-T183907 EST: SGN-E371578 Direction: 3' Facility: INRA
Clone: SGN-C178496 [TUS-29-E22] Trace: SGN-T183908 EST: SGN-E371579 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280481Length: 415 bp (837 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E280481 [] (trimmed) AGTAAAAAGGAGGAGCCAACTTGTATTTCATATTGATAAAGATGTGAATTACAAGCCCAAATAAACTTCCTTCAATACAAATATAACTAATTGAG
AACATAGACAACCAAACATAAAAAGCCATGAACTAAACATCAGACAAACCTTTGTAAAAAAGATTTGCAGATGGTCAGTTCAATTGGCTTAGTAA
TTTTATTAAAACACACAGTAGTAATAATTAATAGAAAAAGAGACATTTTGGTGTCTCAACAGTTGCAAGGGTCACATGTGCAGTTTGATCCACAT
TTGCAGCCATTTCCTCCTTCTGGTGCTTTCTCAGCCACTCCATAGTTCTTCATAGGTGCAACACCCTCAATGATGGTAAAGGTAGTGGTGCTCTC
CAAGTCGGGGTACATTCCACATCCTGCACAGCCAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280481] SGN-U578047 Tomato 200607 Build 2 135 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92035 [Download] [View] Facility Assigned ID: TPRAA30TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.936 Expected Error Rate: 0.0074 Quality Trim Threshold: 12.5