EST details — SGN-E280482

Search information 
Request: 280482Match: SGN-E280482
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72133Clone name: cLER-1-E13
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178497 is on microarray TOM1: SGN-S1-1-2.1.3.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72133 [cLER-1-E13] Trace: SGN-T92037 EST: SGN-E280483 Direction: 3' Facility: TIGR
Clone: SGN-C178497 [TUS-29-E23] Trace: SGN-T183768 EST: SGN-E370427 Direction: 3' Facility: INRA
Clone: SGN-C178497 [TUS-29-E23] Trace: SGN-T183769 EST: SGN-E370428 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280482Length: 333 bp (861 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280482 [] (trimmed) CAAATCCATATTATCAAACTTCATACACATAAGGCACATACATATGCACTTACATACAGAAATATCAAATACAGTACTAACAATTATCCTTCAGA
ATCCAAAAAAAACAAAAGTGAAGGAAATTAAAAACACTTAAAAACCAAAACAACACAGAAACACAATCATAACATCCCAAAAGTAAAATTAAAAA
AACATTTCATTTCATTTAGTCTTTTTCCTTCTCCTTTTCCTCTTCAGCCTTTGAGTGGTATCCTGGTAATTTCTCCTTAATTTTGTCCAAAAATC
CCTTCTTCTCCTTCCCCTCCGCCTCATGCTCCACCGCAGCCGGTGGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280482] SGN-U581375 Tomato 200607 Build 2 231 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92036 [Download] [View] Facility Assigned ID: TPRAA31TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0305 Quality Trim Threshold: 12.5