EST details — SGN-E280557

Search information 
Request: 280557Match: SGN-E280557
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72230Clone name: cLER-1-I6
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185037 is on microarray TOM1: SGN-S1-1-6.2.12.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185037 [TUS-46-F11] Trace: SGN-T1861 EST: SGN-E378470 Direction: 5' Facility: Giov. Lab
Clone: SGN-C185037 [TUS-46-F11] Trace: SGN-T199029 EST: SGN-E397703 Direction: 5' Facility: INRA
Clone: SGN-C185037 [TUS-46-F11] Trace: SGN-T199090 EST: SGN-E397764 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280557Length: 488 bp (974 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280557 [] (trimmed) CGCAGCCAGGGTTTTAGCAAAGCTCAGAAAAGTTTTAAGACATCATGGGTAAAGAGAAGATTCATATCAGCATTGTTGTCATTGGACATGTCGAC
TCTGGAAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGTGGTATTGACAAGCGTGTGATCGAGAGGTTTGAGAAAGAAGCAGCTGAGAT
GAACAAGAGGTCATTCAAGTATGCATGGGTGCTTGACAAGCTTAAGGCTGAGCGTGAACGTGGTATTACCATTGATATTGCCTTGTGGAAGTTTG
AGACCACAAAGTACTACTGCACTGTGATTGATGCTCCTGGACACAGAGATTTCATCAAGAACATGATTACTGGTACCTCTCAGGCTGACTGTGCT
GTCCTCATCATTGACTCCACAACTGGTGGTTTCGAAGCTGGTATTTCCAAGGATGGACAGACCCGTGAGCACGCATTGCTTGCTTTCACCCTTGG
TGTCAAGCAAATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280557] SGN-U578831 Tomato 200607 Build 2 444 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92111 [Download] [View] Facility Assigned ID: TPRAB51TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0048 Quality Trim Threshold: 14.5