EST details — SGN-E280562

Search information 
Request: 280562Match: SGN-E280562
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72269Clone name: cLER-1-K4
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178610 is on microarray TOM1: SGN-S1-1-1.2.4.19
This clone has been mapped as cLER-1-K4.
Additional sequencing 
Clone: SGN-C178610 [TUS-29-J16] Trace: SGN-T184210 EST: SGN-E371443 Direction: 3' Facility: INRA
Clone: SGN-C178610 [TUS-29-J16] Trace: SGN-T184211 EST: SGN-E371444 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280562Length: 607 bp (963 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280562 [] (trimmed) TGATGATGAAGAGTTGCTTGAGCTTGTTGAGCTGGAGGTAAGAGAGTTATTGTCAAGTTATGAGTTTCCTGGTGATGATATTCCTATTCATTGTG
GGTCTGCCCTTTTGGCTTTAGAGGCTTTAATGGCTAATCCTACTATTAAAAGGGGTGATGATCAATGGGTTGATAAGATTTATAAATTGATGGAC
TCTGTTGATGAATATATTCCTATTCCACAAAGACAAACTGAATTACCTTTCTTGATGGCTATTGAAGATGTGTTTTCTATTACTGGTAGAGGTAC
AGTGGCTACAGGGAGAGTGGAAAGAGGGACTGTTAAGACAGGGGAAATTGTTGATATAGTTGGATTGAAGGACACTAGGAACACTACAGTAACAG
GAGTTGAGATGTTTCAGAAGATATTGGATGAAGCAATGGCAGGAGATAATGTGGGGTTGTTGTTGAGAGGTATTCAAAAGATCGATATTCAAAGA
GGAATGGTGTTGGCAAAACCTGGATCAATTACTCCACACACCAAGTTTGAAGCTTTGGTGTATGTGTTGAAGAAGGAAGAGGGTGGCAGGCATTC
CCCTTTCTTTGCTGGTTATAGGCCACAGTTTTACATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280562] SGN-U577523 Tomato 200607 Build 2 62 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92116 [Download] [View] Facility Assigned ID: TPRAB62TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.938 Expected Error Rate: 0.0049 Quality Trim Threshold: 14.5