EST details — SGN-E280598

Search information 
Request: 280598Match: SGN-E280598
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72206Clone name: cLER-1-H3
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178560 is on microarray TOM1: SGN-S1-1-3.4.4.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178560 [TUS-29-H14] Trace: SGN-T184203 EST: SGN-E371436 Direction: 3' Facility: INRA
Clone: SGN-C178560 [TUS-29-H14] Trace: SGN-T184204 EST: SGN-E371437 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280598Length: 431 bp (719 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280598 [] (trimmed) CAACAATATCTCATACCATCAAACACTTACATTTCTCTTGATATAAACACCATGGCAGCTGCTACAATGGCTCTTTCTTCCCCTTCTTTTGCTGG
ACAAGCAGTGAAACTCTCACCATCTGCCTCAGAAATCACAGGAAATGGAAGGATCACTATGAGAAAGGCTGTCGCAAAGTCAGCTCCATCTAGCA
GCCCATGGTATGGCCCTGACCGTGTTAAGTACTTGGGTCCATTCTCTGGTGAGTCCCCTAGCTACTTGACCGGTGAATTCCCTGGTGACTATGGG
TGGGACACCGCTGGACTTTCAGCTGACCCTGAGACCTTTGCCAAGAACCGTGAACTCGAGGTGATCCACTGCAGATGGGCTATGCTTGGTGCTCT
TGGATGTGTCTTCCCTGAGCTCTTGGCCCGTAATGGTGTCAAGTTTGGTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280598] SGN-U579405 Tomato 200607 Build 2 97 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92152 [Download] [View] Facility Assigned ID: TPRAC38TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0087 Quality Trim Threshold: 14.5