EST details — SGN-E280600

Search information 
Request: 280600Match: SGN-E280600
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72209Clone name: cLER-1-H7
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178562 is on microarray TOM1: SGN-S1-1-1.4.4.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178562 [TUS-29-H16] Trace: SGN-T184273 EST: SGN-E371506 Direction: 3' Facility: INRA
Clone: SGN-C178562 [TUS-29-H16] Trace: SGN-T184274 EST: SGN-E371507 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280600Length: 436 bp (725 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280600 [] (trimmed) TTTATCCAACTGCAAAAATATCTCTGCTTTTGTTGTAGACTCTGTTTCTGTAGCTATCCAGAGGCGTGGATACGCGGCCACGGCAGCACAGGGTG
GTGTTTCTGGTAGTGTAAGAGGTAGTGGGAGTGTTAGAAGCAATGTGATGGAATCAAACAAGACTTCATGGGTACCAGATCCTGTTACTGGTTAT
TACAGACCAGAAACTCATGCTAAGGAAATTGATGCTGCTGAACTTAGAAACATGTTGTTGAAGTACAAACCTAGACAAAATTGAAAAAAAAAAAA
GAACAAATTAGAGGATCAAGAATCACGTTTCGATGAGTAGAGACGAATTAGGATTTGGATATTGAAGTTCAATAGTAGAAATATTGTAATTTCTC
ACATATTATGTTTTGTTTTCGCATAAGGAAAATTGTGTATTCAGTTGAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280600] SGN-U580543 Tomato 200607 Build 2 65 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92154 [Download] [View] Facility Assigned ID: TPRAC40TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0158 Quality Trim Threshold: 12.5