Notice: SGN will be briefly unavailable for maintenance. Apologies.

EST details — SGN-E280808

Search information 
Request: 280808Match: SGN-E280808
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C59942Clone name: cLEL-6-N13
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C59942 [cLEL-6-N13] Trace: SGN-T17443 EST: SGN-E234665 Direction: 3' Facility: Cereon
Clone: SGN-C59942 [cLEL-6-N13] Trace: SGN-T17923 EST: SGN-E235145 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280808Length: 214 bp (1406 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E280808 [] (trimmed) CAAATTTTGATTCATCATATGCTTGTGTTTATCCAAAAAAATTAAGCAATGGGGTTGCTTTCTAATAGAATTGATAGAAGCAGCCTCAAACCTGG
AGATCATATTTATTCTTGGCGTACTGCTTATATTTATGCCCATCATGGTATCTATGTTGGGGATAATAAAGTCATTCACTTCACAAGACGTGGTC
AAGAAGTAGGAACTGGAACCATTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280808] SGN-U581528 Tomato 200607 Build 2 34 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T22233 [Download] [View] Facility Assigned ID: tomato060379.t3
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0134 Quality Trim Threshold: 14.5