Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E281064

Search information 
Request: 281064Match: SGN-E281064
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C73904Clone name: cLER-7-A19
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189767 [TUS-58-K13] Trace: SGN-T339955 EST: SGN-E539080 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E281064Length: 475 bp (826 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E281064 [] (trimmed) TTGGTTGGGGCTTTGATCCAGATAATCATAGGAAGTACAAGTATGAAATTGTGGAGATCCTGTCTGAATATGTTGTGGATGAGGGTGTCCAAGTT
GGTTACTTGGATAAAGTGACCAGATTTGTTAGCCTTTTCCAGCGAACAAGGCTGACTGGAGTAGGTACATTCTATGTAAAGCCAAGTGAACTTTT
CAAGTTCTCTCATCGAATTCCTTCTTTCAAAATGACTGGAACTGAACGAGATGGTGTACATGCGGGATCCTTTGAACTTGATCCTGCTTCTTTAC
CCCTCAACCCAGATGATATTTGGTACCCTGAAAAGGTTATGGAAGGCAGTAAGGGTGCAAATTCTCAACCTGTAGAAAATGTTTCACCTGCAGTT
GCATCTGGAACAAGAGATAAGTCTAGAATGTCTGAGAATGTGACGATATCTCTTGAGTCTGTGGAGTTGGATAGCATTCATACTACTAATGGAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E281064] SGN-U592697 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T93527 [Download] [View] Facility Assigned ID: TPRAY10TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0116 Quality Trim Threshold: 14.5