EST details — SGN-E281376

Search information 
Request: 281376Match: SGN-E281376
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C53940Clone name: cLEL-1-N14
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
See unigene SGN-U579338 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C53940 [cLEL-1-N14] Trace: SGN-T2019 EST: SGN-E216503 Direction: 3' Facility: Cereon
Clone: SGN-C53940 [cLEL-1-N14] Trace: SGN-T20908 EST: SGN-E281586 Direction: 3' Facility: Novartis
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E281376Length: 429 bp (590 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E281376 [] (trimmed) AGAGTTTCAAGTATTCAAGCCATGCCAATAGATATCCCGTGTTTTCACGATAAAACAGATTGCAAAGGTACCACGATAACAAGATATAAAACGTC
TTCGCTAAAAAGCAATTATTTATGCTGCAGAATGCACACAACTAGGTCTTGGTACCAATGTCCTTCACAGCACAGATCTGCTCTTCACCCATTGC
AGACATCACAGACAGAACGAGATCCTTTCCTTCCTCAAATCCACCTTTAACCTGGTTCAACAGGGTGTCATCGGTGGGAAGTCTGAGGTCGTCTT
TGGTGTTTCCATTTTCAGTAAGAAGAGACACCTAGCCAAAAGAATGAACCGATGACAACACTCAAAACAGGTATAACAAAAGAATTAGCAAAAAC
AAGTCCAGCTTCAAGATTATAATTAGAACAAACAACTGTTAATTTCAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E281376] SGN-U579338 Tomato 200607 Build 2 131 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T20909 [Download] [View] Facility Assigned ID: tomato010479.x
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0101 Quality Trim Threshold: 14.5