EST details — SGN-E281403

Search information 
Request: 281403Match: SGN-E281403
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C53671Clone name: cLEL-1-C1
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C53671 [cLEL-1-C1] Trace: SGN-T2511 EST: SGN-E216995 Direction: 3' Facility: Cereon
Clone: SGN-C53671 [cLEL-1-C1] Trace: SGN-T20551 EST: SGN-E281202 Direction: 3' Facility: Novartis
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E281403Length: 344 bp (609 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E281403 [] (trimmed) GAACTGAAATTGTAACCAGAAGAAATTACAACACTCCATATCTCCTTAGAGAGCTTACCAAATATTTGGCAACTGAGATCATACAGTGTTCTTAA
TTTCAAATAGCTATACAAAAATCTTCTATGAGATTCATAAGGTGTAGAGTAGATTTATTAACAGAAAAACTGGAATTAAACTAAACTGTTATCAT
CAGGCAAATCAAACAACGATTATTCGAAAACAACTTGCAACTATATGCTTACTACTTCTGGCCTTTTTTCAATAAAACACCAATCTTTTTCAACA
TGTTTCCATTCTTCTTCTTGGGAGAGTCATCATCTGGTGTCTTCAGAATAACGGTGAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E281403] SGN-U584659 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T20552 [Download] [View] Facility Assigned ID: tomato010113.x
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.917 Expected Error Rate: 0.0085 Quality Trim Threshold: 14.5