EST details — SGN-E281502

Search information 
Request: 281502Match: SGN-E281502
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C53971Clone name: cLEL-1-O20
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C53971 [cLEL-1-O20] Trace: SGN-T2304 EST: SGN-E216788 Direction: 3' Facility: Cereon
Clone: SGN-C53971 [cLEL-1-O20] Trace: SGN-T2382 EST: SGN-E216866 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E281502Length: 387 bp (1049 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E281502 [] (trimmed) GTAAAACCCATAACCAAATTCAACACCATCAACACCACCACTGGACGGCTGAGCAGTCGCAGACTGCCCTTCACAGTTAGAATGTCAGCCGCCAC
TACCACCCCACCAACTTCAAAGCCCTCCAAGAAACCTCAGAAACAAGGAATCAAAGAGTCCCTTTTGACACCAAGATTTTACACTACTGATTTTG
ATGAAATGGAGACCCTTTTCAACACTGAGATCAACAAGAACCTGAATGAGGCTGAGTTTGAAGCCCTTTTGCAGGAATTCAAAACTGATTACAAC
CAGACTCATTTTGTTAGGAACAAGGAGTTTAAAGAAGCTGCTGATAAAATTCAGGGACCTTTAAGACAAATCTTTGTTGAATTCTTGGAGAGATC
TTGCACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E281502] SGN-U574472 Tomato 200607 Build 2 157 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T20743 [Download] [View] Facility Assigned ID: tomato010294.t3
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0099 Quality Trim Threshold: 14.5