EST details — SGN-E281592

Search information 
Request: 281592Match: SGN-E281592
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C53994Clone name: cLEL-1-P2
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C53994 [cLEL-1-P2] Trace: SGN-T2596 EST: SGN-E217080 Direction: 3' Facility: Cereon
Clone: SGN-C53994 [cLEL-1-P2] Trace: SGN-T20920 EST: SGN-E281382 Direction: 3' Facility: Novartis
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E281592Length: 410 bp (593 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E281592 [] (trimmed) GCATCGCAATAACAATACTCATATATATCCCTATGTTCTTGTAATTTACAATTAGCAAACAACTAATTTTTTAAAAACTTCACTTTCCGGGGACA
AAGTTTGTGGCGAAGGCCCAAGCATTGTTATTGACTGGATCAGCGAGATGGTCAGCAAGGTTCTCCAATGGACCCTTTCCGGTGACGATAGCTTG
AACAAAGAATCCGAACATGGAGAACATAGCAAGTCTACCATTCTTGATCTCTTTTACCTTGAGCTCAGCAAAAGCCTCTGGGTCATCAGCAAGGC
CCAGTGGGTCAAAGCTACCACCAGGGTAGAGTGGGTCAACAACCTCACCAAGAGGCCCACCAGCAATACGGTAACCCTCAACGGCTCCCATCAAC
ACAACTTGGCAAGCCCAGATAGCCAAAATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E281592] SGN-U579181 Tomato 200607 Build 2 140 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T20921 [Download] [View] Facility Assigned ID: tomato010485.x
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0096 Quality Trim Threshold: 14.5