EST details — SGN-E282544

Search information 
Request: 282544Match: SGN-E282544
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C71650Clone name: cLER-18-J3
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190000 [TUS-59-E6] Trace: SGN-T340355 EST: SGN-E539480 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190000 [TUS-59-E6] Trace: SGN-T340358 EST: SGN-E539483 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E282544Length: 549 bp (860 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E282544 [] (trimmed) CAGTAGCTGTAATCTCCGGGAACGATAGTGTGCAAGGATCCTTACAATTCATCCAGCAATCCAATGGTGTTACCCATGTGAGAGGAAGAATAATT
GGTCTAGCTCCAGGTCTTCACGCTTTCCATATCCATGCCTTGGGTGATACCACTAACGGCTGCAATTCCACTGGACCTCATTTTAATCCACTTAA
GAAAGATCATGGAGCTCCCATGGATGAAGTACGTCATGCGGGTGATTTAGGCAACATTGTTGCTGGTCCTAATGGGGTGGCAGAGATATCAATTT
CAGATATGCAGATTCCTCTTAGTGGAGTACACTCCATCTTGGGGAGAGCAGTAGTTGTGCATGCTGATCCTGATGATCTGGGAAGAGGTGGACAT
GAACTTAGTAAGACAACTGGAAACGCAGGTGCAAGAGTTGGCTGTGGCGTTATTGGGCTTCAATCATCTGTCTAATGTTTGTGTTACTCAGTTAA
TCATGTTAAACTAGCAATACTCTCAACTTTCCATATATCTCAAAGAGCTGATTAATAAAATAGTAGTGATTTAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E282544] SGN-U584417 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T96340 [Download] [View] Facility Assigned ID: TPRCS50TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0184 Quality Trim Threshold: 12.5