EST details — SGN-E282617

Search information 
Request: 282617Match: SGN-E282617
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C70715Clone name: cLER-15-K5
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178797 is on microarray TOM1: SGN-S1-1-6.2.3.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178797 [TUS-30-B11] Trace: SGN-T184647 EST: SGN-E372207 Direction: 3' Facility: INRA
Clone: SGN-C178797 [TUS-30-B11] Trace: SGN-T184648 EST: SGN-E372208 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E282617Length: 534 bp (781 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E282617 [] (trimmed) TTTCAACAACTCCATGGACAATCCCTATTGCCTAGTTATTATTCTTGCATTGATCTTTTGCCCTATTCTTGTGAGAGCTCAATCTTTTGATTTTG
CTTACAATGGATTCAATAACTCAAATATCATTAGAGACGGAGTAGCAATAATCAATTCAAGTGGTGCACTTAAGCTCACTAATAGATCATATAAT
GTTATAGGTCATGCTTTCCACCCCAATCCTGTACCAATTTTCAACTCCAGTACTAAAAATGTTACTTCATTTAGTACATACTTCGTCTTCGCCAT
CGTCCCTCTTGAGAAAACCTCTGGTGGCTTTGGCTTTGCTTTCACCTTATCTCCATCCCCGGGTTTTCCGGGTGCTCAGGGTGATCATTTTCTTG
GAGTCGTCAACATTATGAACGATGGCAATGATACTAACCACATCTTCATGGTTGAATTTGACACTGTGAATGGTCACAATGAAGGTGTAGACACA
GATGGAAATCACATTGGGGTCAACAGAAATGGCATGAGCCCTACAGCGTCAAAATCAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E282617] SGN-U571757 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T95137 [Download] [View] Facility Assigned ID: TPRCE63THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0048 Quality Trim Threshold: 14.5