EST details — SGN-E282795

Search information 
Request: 282795Match: SGN-E282795
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C70790Clone name: cLER-15-O17
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178824 is on microarray TOM1: SGN-S1-1-3.3.3.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178824 [TUS-30-C14] Trace: SGN-T184573 EST: SGN-E371959 Direction: 3' Facility: INRA
Clone: SGN-C178824 [TUS-30-C14] Trace: SGN-T184574 EST: SGN-E371960 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E282795Length: 513 bp (746 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E282795 [] (trimmed) AGCCGTCCTAAGAGGAGATCTAAATAAGATTACAGTAGGGTTCTGCTCTAGCATTCAGGAAAAATGTGTGGTTCACGCTGCTTGGTCTTCTCCTA
CAGGGCTGCCAGCAGAAACAGTAGTAGACAGGTACGTTACAGTTGGTGCATACTGTCTGTTGCGATCCTGCACAATTGAGCCAGAATGCATTATA
GGGCAGCACTTTATCCTTATGGAAGGTTCATTGGTGGAGACTAACTCGATCCTTGAAGCTGGGTCGGTGCTCCCACCTGGGAGGAGGATTCCAAG
TGGTGAACTCTGGGCTGGGAATCCCGCAAGATTTGTCAGGACCTTGACCCATGAAGAGATAAAAGAGATACCTAAACTTTCCACTGCAATAAATG
ATTTGGCCAATGCTCACCACTCAGAATTTCTGCCTTACTCCACCGTATATTTGGAAGTTGAGAAGCTTAAGAAGTCATTTGGTATTTCGATTTAG
AAGTTCTGTTTTTTTCGATTGTACTTGTTGGGAGGAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E282795] SGN-U572571 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T95315 [Download] [View] Facility Assigned ID: TPRCE93THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0072 Quality Trim Threshold: 14.5