EST details — SGN-E282863

Search information 
Request: 282863Match: SGN-E282863
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C70677Clone name: cLER-15-J1
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178784 is on microarray TOM1: SGN-S1-1-3.1.2.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178784 [TUS-30-A22] Trace: SGN-T184565 EST: SGN-E371951 Direction: 3' Facility: INRA
Clone: SGN-C178784 [TUS-30-A22] Trace: SGN-T184566 EST: SGN-E371952 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E282863Length: 450 bp (751 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E282863 [] (trimmed) TTTTTTTTGTAATATACTCCCGATACCAAAACAATATGTAACCAAAATAAAATCAATATTCACATTTATTTTTTTAAAAAAACTAAAACAAAAAC
CATTGATTGTCCCAAAACTAAACAATTTGTAAATTCAAAATGGTCAATTCTATATGATACTTTCTTTAAAATATTTTATTCTATGCTAACTCTGG
AATCACCCTATCAGCTGCTTTCTTTGCCTCTTTGTCCCAATTTGTTCTGAGAGTAACTACTAAATAAATGAGGGCTTGAGCAAGAAGTGATAGAG
TGAGACCCAACCAAAGTTCCTTTTCTCCAACATGGTAGAAAAAAGCTTATACAATACCAGCAGGTATTCCCCATAGATAATAAGCTCCCAAATTA
ACAATTGCACCTATTTTTTGCCAACCACATCCTCTAGCAATACCTAAAATTTTTACATTATTATTAAAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E282863] SGN-U572131 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T95383 [Download] [View] Facility Assigned ID: TPRCG49THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.906 Expected Error Rate: 0.0195 Quality Trim Threshold: 14.5