EST details — SGN-E282887

Search information 
Request: 282887Match: SGN-E282887
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C70811Clone name: cLER-15-P23
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178837 is on microarray TOM1: SGN-S1-1-6.4.3.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178837 [TUS-30-D3] Trace: SGN-T184744 EST: SGN-E372304 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E282887Length: 381 bp (742 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E282887 [] (trimmed) TAATGGTAGGTGACGGCATCAATGATGCCCCAGCACTTGCTGCAGCTACTGTTGGTATTGTACTGGCTGAGCGAGCTAGTGCCGCTGCGGTAGCT
GTTGCTGATGTACTATTGTTGCAAGACAATATTTCTGGTGTCCCATTTTGTGTTGCAAAATCTCGCCAAACAACATCCTTGATCAAGCAAAATGT
AGTACTTGCTTTGTGTAGCATTATTTTGGCATCTCTTACATCAGTTATGGGGTTCCTCCCACTCTGGTTGACGGTGCTCTTGCATGAAGGTGGCA
CACTTCTTGTTTGTCTTAATTCCGTTCGTGCGCTAAACCCTCCGACATGGTCATGGAGAGAGGATATTTCACAAATCATTGACAGATTGCGGTCT
C
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E282887] SGN-U564914 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T95407 [Download] [View] Facility Assigned ID: TPRCG96THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0201 Quality Trim Threshold: 14.5