EST details — SGN-E282912

Search information 
Request: 282912Match: SGN-E282912
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C70727Clone name: cLER-15-L18
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178801 is on microarray TOM1: SGN-S1-1-2.2.3.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178801 [TUS-30-B15] Trace: SGN-T184649 EST: SGN-E372209 Direction: 3' Facility: INRA
Clone: SGN-C178801 [TUS-30-B15] Trace: SGN-T184650 EST: SGN-E372210 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E282912Length: 527 bp (697 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E282912 [] (trimmed) ACTACTACTCTTCTCAAACAAGAAAAATTAGTAAATGTAACAAACGTATCGCAAGACCCACAAGAATTCAATACAAACACCATATCTGCAGTTTT
TAGCTTTTCTTGAGGTTTTTTTTCATGTTCGATGGCCTCAAGTGCTTCAAGATTCATCAAATGTGTCACGGTTGGTGATGGGGCTGTTGGCAAGA
CTTGTATGCTTATTTGCTATACCAGTAACAAGTTTCCCACTGACTATGTTCCGACGGTGTTTGACAACTTCAGCGCCAATGTGGTTGTTGAAGGG
ACCACAGTAAATTTAGGTCTTTGGGATACTGCAGGACAAGAAGATTATAACAGATTAAGGCCACTGAGCTACCGAGGAGCAGATGTTTTTGTCCT
AGCGTTCTCCTTGGTGAGTCGTGCAAGCTATGAAAACATACTTAAGAAGTGGATTCCCGAACTTCAGCATTATGCTCCTGGAATTCCGGTGGTAT
TAGCTGGCACCAAACTTGATCTTCGTGAGGATAAGCACTTCTTGGCTGATCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E282912] SGN-U570513 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T95432 [Download] [View] Facility Assigned ID: TPRCH69THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0048 Quality Trim Threshold: 14.5