EST details — SGN-E283217

Search information 
Request: 283217Match: SGN-E283217
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C71259Clone name: cLER-17-F24
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178864 is on microarray TOM1: SGN-S1-1-3.1.3.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178864 [TUS-30-E6] Trace: SGN-T184499 EST: SGN-E371885 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283217Length: 448 bp (836 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E283217 [] (trimmed) GTGAAGAGAGGTGAAGATAACTGAAGAACTTGTTCTCTTTTCCGATACAAGCTGAAGAGTCGAAGAACTGAGCAGAAGAGTTGAACGATTCCTTG
AAGATGTGCAGCCAAAGACAACAATGAAGAACCATCAAAGCCTGAAATGTTTATAGCAACTCGTACCAAGACAAGAAAGGAAATCCAGGCCGATA
CCCAAGTTGCAATAGTAAATTTTTTAAAGAGGATTAGAACGAAATTTGATTCAAACTTAAATTTATATATTGTGGGGGAGTTTGATTCCATTGAA
TTTTGTCAAGTACGCCTTCTTTTTCTTTCTCATTTTCTTCATTTTGTTCAAGTGCGAGGAGGTATTAATTCTTAGTCGATGTCTCTATCATATGA
CTTGAAATGAAATAGTACTCATAATTCACTATGGATGCCAATTTTTTTCAACAGACTGAACTTCAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283217] SGN-U587194 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T96068 [Download] [View] Facility Assigned ID: TPRCP36TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0137 Quality Trim Threshold: 14.5