EST details — SGN-E283444

Search information 
Request: 283444Match: SGN-E283444
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C69789Clone name: cLER-12-J23
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185358 is on microarray TOM1: SGN-S1-1-5.3.9.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185358 [TUS-47-C20] Trace: SGN-T191931 EST: SGN-E390605 Direction: 5' Facility: INRA
Clone: SGN-C185358 [TUS-47-C20] Trace: SGN-T192173 EST: SGN-E390847 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283444Length: 538 bp (890 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E283444 [] (trimmed) CTTTCAACTTTTTCTTTAATCTCAAACCTCAAATTTAACTAAACACTTTCCCATGGCTCCTGCTCCATCTGAGACAATAACTACCGATGTATCAT
CGGAAAACAATAATGTTACCATCACTGGGAAGATATACACACGAGTTCGTCTTGCTACGAAATCTGATTTGTCTCATATATACAAATTGTTTTAC
CAAATCCATGAATACCATAACTTCACTCATTTATACAAAGCTACTGAGTCCTCCTTAGCCAACTTGCTCTTTAAAGAAAACCCTCTTCCACTTTT
CTACGGTCCATCCGTACTTCTACTTGAAGTCTCTCCAACACCTTTTGACGAACCTAAAAATACTACAGACGAAGGGTTCAAGCCTATCCTTACAA
CGTTTGACCTTAAATTCCCAGTCGTAGAAGGAGAAGTTGAGGAATTCCGATCCAAATATGATGATAAGAGTGATGCTTACATTGCAGGATATGCT
TTCTTTTACGCGAATTATTCGTGTTTCAATGACAAACCTGGATTCTATTTTGAAAGTCTTTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283444] SGN-U579042 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T94411 [Download] [View] Facility Assigned ID: TPRBU60TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0049 Quality Trim Threshold: 14.5