EST details — SGN-E283521
| Search information |
| Request: 283521 | Match: SGN-E283521 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C69717 | Clone name: cLER-12-G12 |
| ||
| Library Name: cLER | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: leaf
Development Stage: 4 weeks
Microarray: Alias clone SGN-C185991 is on microarray TOM1: SGN-S1-1-4.2.7.7
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C185991 [TUS-48-N5] | Trace: SGN-T197761 | EST: SGN-E396435 | Direction: 5' | Facility: INRA |
| Clone: SGN-C185991 [TUS-48-N5] | Trace: SGN-T197800 | EST: SGN-E396474 | Direction: 3' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E283521 | Length: 185 bp (1008 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E283521 [] (trimmed)
CAGGTGGTCTCATTAACTATACAAGTAAAGTTCAGGGTGGTTTTATCATATTTTCCGCGCAAAAACGCTGATTTTTGTCTTGTTGAAGTTCATCA
TCTTCCATGTTTACTGTATATTCTTGTACTCAGATTTGCAATGTATGTCAACCCTGTAGATTCAGGCAATTGTGCAATAAAATTGATGTT
TCTTCCATGTTTACTGTATATTCTTGTACTCAGATTTGCAATGTATGTCAACCCTGTAGATTCAGGCAATTGTGCAATAAAATTGATGTT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E283521] | SGN-U575401 | Tomato 200607 | Build 2 | 9 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T94488 [Download] [View] | Facility Assigned ID: TPRBT42TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.850 | Expected Error Rate: 0.0064 | Quality Trim Threshold: 14.5 |
Working
