EST details — SGN-E283736

Search information 
Request: 283736Match: SGN-E283736
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C77017Clone name: cLES-1-G23
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C77017 [cLES-1-G23] Trace: SGN-T97411 EST: SGN-E283735 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283736Length: 555 bp (787 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E283736 [] (trimmed) ACACAAAACAAACACACTTTTATAAATAGACGCAACAGGAACAGAAACCAACAACATGACACAATTCAAAGTGCAGAAACATAAAAGGCTTCTGG
TGGAACACCAAAAGGCAAGACTAGTTGAGAAATTGCACACAGACGTTGCAAATCCCAACAGACACAAGTTTGGACGTATAAGTCCATTATTCTGA
GAAAACAACAGACACTGAAATAAAAACAACAATACGACCCTCAAGACAACACTACTCCTTTCCTTCTTTCTCTTCCTCCTTCCAGCAGCCCTTCA
GAACGGACTTGGGAGATTCACAGTAAGGAGTTCTAGTGAACTTCTGGTAGACAATGGAACCGCCTTTGCCAAACTCTTCTGGACTCCACTCAGCA
AGAGAGTAGCCCTTAACATCAACAGAGCAAACATGCTCCAGTAACTTGGTAGCAACATCAGCATGCAGAGCAATAGAGAACTCAGCTGGCTCAAA
ACATGCAAGCACCCTCTCAACCAGGGGACCCAACTCATTGGTTTTAGGATCATATCCAACAGATTCAAAGCTGGCATAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283736] SGN-U580064 Tomato 200607 Build 2 541 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T97412 [Download] [View] Facility Assigned ID: TPSAA48TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.941 Expected Error Rate: 0.0020 Quality Trim Threshold: 14.5