EST details — SGN-E283753

Search information 
Request: 283753Match: SGN-E283753
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C77072Clone name: cLES-1-K3
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C183426 is on microarray TOM1: SGN-S1-1-1.3.2.19
This clone has been mapped as cLES-1-K3.
Additional sequencing 
Clone: SGN-C77072 [cLES-1-K3] Trace: SGN-T97428 EST: SGN-E283752 Direction: 5' Facility: TIGR
Clone: SGN-C183426 [TUS-42-C8] Trace: SGN-T195011 EST: SGN-E393685 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283753Length: 370 bp (852 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E283753 [] (trimmed) GGAATATCGAAATGCATATAACTGAATTGATCTAATCATCCCATTCCAATGGTTTATAACAACTGGCCATAAAATAAAAAACTAAAATATACGAA
GGAGCATATTCCCAGAGAGTATGACATGCTCTGATCCAAGAACAAGATAAAGACATTCTAAAACTTACAACCATCATCACTCAGAACGATTGGCA
TACCTCTCCACCTTTTCATCAAGATTGATTCCAACCATAGCCTCACCAAGCCCACAGCTAATTTCAGCCAGCAATTGGGGGTCACTGTAATGAGT
CACTGCTTGCACGATGGCACGTCCCCTCTTTGCAGGGTCACCACTCTTGAAGATACCAGAACCCACGAACACGCCGTCACATCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283753] SGN-U577360 Tomato 200607 Build 2 70 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T97429 [Download] [View] Facility Assigned ID: TPSAA62TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0130 Quality Trim Threshold: 14.5