Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E284030

Search information 
Request: 284030Match: SGN-E284030
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C70046Clone name: cLER-13-G23
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C186002 is on microarray TOM1: SGN-S1-1-1.2.7.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C186002 [TUS-48-N16] Trace: SGN-T192442 EST: SGN-E391116 Direction: 5' Facility: INRA
Clone: SGN-C186002 [TUS-48-N16] Trace: SGN-T192766 EST: SGN-E391440 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E284030Length: 485 bp (894 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E284030 [] (trimmed) ATAAGAAAAATCAATTCTATTGTTCAAGTAAACTCACAAATTACAACTTTACATGGTCAACAAATGATCAGAAACTTGAGAATGTTTTAAGATTT
TTATTTTCCGGGGACAAAGTTTGTGGCGTAAGACCAGGCGTTGTTGTTTACTGGGTCTGCAAGGGGATCAGCAAGGTTCTCCAATGGTCCCTTTC
CAGTAACAATGGCTTGAACAAAGAATCCAAACATAGAGAACATAGCATGTCTACCGTTCTTAATCTCCTTTACCTTGAGCTCAGCAAATGCCTCA
GGGTCTTCAGCAAGGCCTAATGGGTCGAAGCTGCCACCTGGGTAGAGTGGGTCTACAACCTCACCAAGAGGTCCACCAGCAATACGGTAACCTTC
AACGGCTCCCATGAGTACAACTTGGCAAGCCCAGATGGCCAATATGCTCTGTGCATGGACCAAGCTTGGGTTGCCCAACGAAAAAAGCAATAAAG
AGAAAATCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E284030] SGN-U580356 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T94724 [Download] [View] Facility Assigned ID: TPRBW48TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0103 Quality Trim Threshold: 14.5