EST details — SGN-E285125

Search information 
Request: 285125Match: SGN-E285125
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72683Clone name: cLER-20-O17
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190089 [TUS-59-H23] Trace: SGN-T340508 EST: SGN-E539633 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190089 [TUS-59-H23] Trace: SGN-T340511 EST: SGN-E539636 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E285125Length: 585 bp (831 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E285125 [] (trimmed) GTTCAATGCTCACTTCTCAGCAGATGTTTTCACCAATATTCTTTTTCAGGATGGTACTCTTGAGGGCGTGGAGCGGGAGGTTGCCTCCTTATTTC
ACCTTCCCCACAATTTTCAGCTAATAATTGATCACGAGCTTCAACATGTGGTACACCTTTTTATATATAAATACATACTTCATATATTTAATATA
CACACAAACATCTTTATAATAACATTTCATTATAATAATATTAAGTTCTCTTTGAAATATTTGGATTAAAAACAGTACTCCCTCCATCTGAAATT
ATTAGTCATGTTATGCTTATCAAAAGTCAATTTAACTAGTTTTCAAAGGTAAATTGGATCACTATAATTCGATATTTTAAATAAAAATACTAGAT
ATTCTAAAACTATATGAAAAGTACTGTAAATCATAATTTTTTTTACATATTAATATGATTAAAAAAATACATCTAATATTAATAATTTGATTCTA
AAAATAGAAATTATAACGAACAATAATGGAGGGAGTAATAATAAAGTTAATACAAGAATTTATCCATATACATGTAACTAAAATAAATAAACAAT
CTCTATTAAATACAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E285125] SGN-U578466 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T96697 [Download] [View] Facility Assigned ID: TPRCY93TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.905 Expected Error Rate: 0.0030 Quality Trim Threshold: 14.5