Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E285673

Search information 
Request: 285673Match: SGN-E285673
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C78487Clone name: cLES-5-N1
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178993 is on microarray TOM1: SGN-S1-1-2.2.2.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178993 [TUS-30-J15] Trace: SGN-T184695 EST: SGN-E372255 Direction: 3' Facility: INRA
Clone: SGN-C178993 [TUS-30-J15] Trace: SGN-T184696 EST: SGN-E372256 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E285673Length: 325 bp (779 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E285673 [] (trimmed) GATCAAAGTCTTGGAGAATATCAGATATATGACCAATACAACGATGACTCTTATTCCGAAGATGAAGACTACTAAAACATCATGCTAATTAGTGA
TGGAGTGAAGAACTGCTGCTGCAGAAAAGGGTGGGAATGAAGCATTTACCTGACCTCAAGCCTACAGGGAAAAAGCTTAGTGTTGTCAGTATTTC
CCCCTAAACTTGTTCTGGAAAATCACTAGGCACATTTTAACTTTACGAGCATCCTATTACTCTGAACTTATATTAAGACAACCCCGCGACCCTAA
GCTGCCATTTGGGGAAGGTTGTGAACACCTCCAGTTAGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E285673] SGN-U572643 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T98156 [Download] [View] Facility Assigned ID: TPSAS73TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0273 Quality Trim Threshold: 14.5