EST details — SGN-E286000

Search information 
Request: 286000Match: SGN-E286000
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C75240Clone name: cLES-13-F24
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185525 is on microarray TOM1: SGN-S1-1-6.2.9.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185525 [TUS-47-J19] Trace: SGN-T192351 EST: SGN-E391025 Direction: 5' Facility: INRA
Clone: SGN-C185525 [TUS-47-J19] Trace: SGN-T197770 EST: SGN-E396444 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E286000Length: 520 bp (780 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E286000 [] (trimmed) TTTCACCTAGTTCCCCATTCCCCTCTCCCCTCTCCTCTTTTGCAGCCGACGGAGAAATGACTACCCGTTTCAAGAAGAACAGGAAGAAGAGAGGT
CACGTCAGTGCCGGACATGGACGTATCGGTAAGCACAGGAAGCATCCTGGAGGTCGTGGTAATGCTGGAGGTATGCACCATCACCGTATCCTTTT
CGATAAGTACCATCCTGGTTACTTCGGAAAGGTAGGTATGCGTTACTTTCACAAACTCCGCAACAAGTTCTATTGCCCTACCGTCAACATCGACA
AGCTCTGGTCACTTGTACCTCAAGAGGTGAAGGACAAGGCTGCTGCTACCAAGGGTAGTGCTCCCGTGATCGATGTTACCCAGTATGGTTACTTC
AAGGTATTGGGTAAGGGTGTTTTGCCGGAAAACCAAGCTGTGGTGGTGAAGGCTAAGCTTATTTCAAAGAATGCTGAGAAGAAGATTAAGGAGGG
TGGTGGTGCCGTTGTGCTCACTGCTTACGTTTGCTTTTCTTCGTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E286000] SGN-U577959 Tomato 200607 Build 2 73 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T100313 [Download] [View] Facility Assigned ID: TPSBZ36TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.985 Expected Error Rate: 0.0071 Quality Trim Threshold: 12.5