EST details — SGN-E286195

Search information 
Request: 286195Match: SGN-E286195
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C74797Clone name: cLES-11-I21
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E286195Length: 148 bp (258 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E286195 [] (trimmed) GCAGACCTAGCCATAAGGCTAACCATGGGGTGAGTTTCACTTGCAACTAAAAAACACAGACACATTACACTTTTAAACTCTCACCTGTTTCAGAT
AAAAAATTTCAAAAGTCTTTCATTGTTTCTTAAAGTTTATGTCAAGTCAAAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E286195] SGN-U603084 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T99726 [Download] [View] Facility Assigned ID: TPSBO59TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.939 Expected Error Rate: 0.0156 Quality Trim Threshold: 14.5