EST details — SGN-E286636

Search information 
Request: 286636Match: SGN-E286636
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C74950Clone name: cLES-12-D19
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185517 is on microarray TOM1: SGN-S1-1-6.2.9.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185517 [TUS-47-J11] Trace: SGN-T192348 EST: SGN-E391022 Direction: 3' Facility: INRA
Clone: SGN-C185517 [TUS-47-J11] Trace: SGN-T192349 EST: SGN-E391023 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E286636Length: 579 bp (780 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E286636 [] (trimmed) TTAGAATCAGCAATTTATTATAATTGTCTTATATAGTCCTATAAATTTGTCAAACTTGAATCAACATTTTCATAAGCAACCTCAAATCATCCAAA
ATGGGTCTTCAAACTGATATGTACCCTTCAAATGGCTTCAAGCAGCAGCTTAGCTACTATGACGATAACGACTACTATTCATCGGAGGATAATTA
TTACAGCAACAATGGCTCAAGCATGCAAATGAAGAAGCCTTATGGTTATCCCACCTCTAGTCCAACCCAAAATCATCACATGATGATGAGCCATG
GCGGCTATAGCCACGATGACAAGTACCAATATGGGCATATGTCTCATGATTCTGCTAATAGTTCCAGCTATGGATCAAGTGGTTTTCAACACACT
TCCAACATGAATGGTGGCTATGGATCAAGTGGAATGCAACACTCTTCCCACGCGAATGCTGGCTATGGAAGTGCGATGTATGGAAGTGCAATGCA
ACAATCTTCCCACATTAACGGTGGCTATGGAAGCGGAATGCAGCATGCTTCCCACATGAGTGGTGGCTATGGAAAGCGAATGCAACATACATCCA
ACATGACTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E286636] SGN-U582655 Tomato 200607 Build 2 52 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T100167 [Download] [View] Facility Assigned ID: TPSBU22TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0088 Quality Trim Threshold: 14.5