EST details — SGN-E286874

Search information 
Request: 286874Match: SGN-E286874
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C75507Clone name: cLES-14-F4
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185531 is on microarray TOM1: SGN-S1-1-8.3.10.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185531 [TUS-47-K1] Trace: SGN-T192080 EST: SGN-E390754 Direction: 5' Facility: INRA
Clone: SGN-C185531 [TUS-47-K1] Trace: SGN-T192592 EST: SGN-E391266 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E286874Length: 592 bp (810 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E286874 [] (trimmed) TTTACAGAAAGTACCAATTCAATTCATATTAATGACAAAACAGACATAAAAAAGACATCATTTCTTACTGGAAATAAAGGGAATTACAAGGAGGT
TACTCTATTTGAGACTAATATTCATGACATAAGAAAATTAACTCCACAAGATGCTGCGCAAATCATCAGTGCCATAATTGCCAAGAAATTGTATT
TCCCAAGAGTAAGCCGATTTTGGGGATCGCCAGTGGAATAACCAGTGAAGTAGAAATAGCGAGATACAATATAAACAGCTCCAAGAGATGCACAA
ATCAAGGGGTGCCTAATTCCTCCAACAATCATCAGCATGAAAAATGTTGGCATCATTTCTAATGAATTCTGATGACCTCTCTGAACACAGTTAAA
GGAATTAGCATTCTTGTTTTCAGCTTCAGTAGCATACATTGTTGGATAAGGAACCTTGTACTGTTTGCGGGCTTTGCCGACTTGAAAGGACATCC
AGAAGTTGAAGAAACAGTAGACGACAAGAGCAAGAATTACATATCCATATTCTTTGGGGAGGAATTCAACTCCGGCCATGGTTTTTTTCCGATTT
GGTGTTTTGCACTTTGGCGGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E286874] SGN-U580456 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T100695 [Download] [View] Facility Assigned ID: TPSCD26TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0036 Quality Trim Threshold: 14.5