EST details — SGN-E287002

Search information 
Request: 287002Match: SGN-E287002
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C78834Clone name: cLES-6-O20
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185480 is on microarray TOM1: SGN-S1-1-3.4.9.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185480 [TUS-47-H22] Trace: SGN-T192485 EST: SGN-E391159 Direction: 5' Facility: INRA
Clone: SGN-C185480 [TUS-47-H22] Trace: SGN-T197778 EST: SGN-E396452 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E287002Length: 671 bp (887 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E287002 [] (trimmed) TCTCAATAGAGCTTAACTAGTTGCTCGCTGCAGAGAAGAAATGGCGAATTTGCGAAGGGCACTTCTCTTCACCATTCCTCGAATCATCAATTCCT
CTAAAACAGCATCTGTTGCAACCTCCACACTCCAGTCTCACAATCTCTACAGGCCTTTAGCTGGAACATTTTCGCGTTTTATTTCTTCTAATGAG
ACTTCATCGCCGATGAATATCGATCTTTCCGACGAAGAGAGCAAAAGACGTTTGTTTAACAGGCTTATTTATCGTAGTAAACAGAGAGGTTACCT
GGAGCTAGACCTTGTTCTTGGAAAATGGGTGGAGGAACATATACAATCCATGGATGAAAATGGAATTAAGTCCCTTGTTCATGTCCTTGACCTGG
AGAATCCAGATTTGTGGAAGTGGCTGACTGGTCAGGAGCAACCCCCAGATGCAATAAGCACAAATCCTGTGTTTTCTGCTGTGCATGAAAAGGTT
ATGAACAACCTTAACAATCATACTTCTCCCGAGACTCGTGCTGTTCCAGGAAAACCTTGGGTGAGAGGGTGGGATGATATCAAGAGAGGCCGTGA
TGCACCTATAGCTGGGAACCAGTAGTTATTTTTCTGCTTGAAGGTGTCAAAGAAGAACTGATTTGTAGTCTTGTATAGGGACTCGTTATTACTAT
GTATGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E287002] SGN-U576422 Tomato 200607 Build 2 29 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T98454 [Download] [View] Facility Assigned ID: TPSAV94THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0080 Quality Trim Threshold: 14.5