EST details — SGN-E28777

Search information 
Request: 28777Match: SGN-E28777
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C14731Clone name: cLEC-8-G20
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183997 is on microarray TOM1: SGN-S1-1-6.3.19.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C14731 [cLEC-8-G20] Trace: SGN-T25173 EST: SGN-E200084 Direction: 5' Facility: TIGR
Clone: SGN-C183997 [TUS-43-K3] Trace: SGN-T196262 EST: SGN-E394936 Direction: 5' Facility: INRA
Clone: SGN-C183997 [TUS-43-K3] Trace: SGN-T199693 EST: SGN-E398367 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E28777Length: 410 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E28777 [] (called/trimmed by facility)
CTCTATCTTTTTCTCTCTGTTTTCACCTTTTATCTCCTCCGGTGTATGGCGGCGGCCCATCTTCGCGGGCGTAAAACTCGACTCCCGCCGGGAAC
CCTTGGCCTCCCGTTTATCGGAGAAACCCTCCAGTTAATTTCTGCGTACAAAACGGAAAATCCTGAACCGTTCATCGATGACCGTGTTTCAAAAT
ACGGCAGCATTTTCACGACCCATGTTTTTGGTGAACCGACGGTTTTCTCTGCTGACCCGGAAACGAACCGGTTTATTTTGCAGAATGAAGGTCGG
CTTTTTGAGTCGAGTTATCCCGGTTCGATACAGAATTTACTTGGGAGATACTCTCTGTTGCTTATGAGAGGAAGTCTACACAAACGAATGCATTC
ATTAACTATGAGTTTTGCTAATTCTTCCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T25173 [Download] [View] Facility Assigned ID: TCABD46TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence