EST details — SGN-E288154

Search information 
Request: 288154Match: SGN-E288154
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C78881Clone name: cLES-7-B13
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190236 [TUS-59-O2] Trace: SGN-T340760 EST: SGN-E539885 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190236 [TUS-59-O2] Trace: SGN-T340763 EST: SGN-E539888 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E288154Length: 443 bp (865 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E288154 [] (trimmed) GGCTGCAGGTCGTATCGAGTGGGGTACGGGGGTAGTGGTCTCCAAATGCCGGCGAATTATGGGGACTATTTCATTGGACCGGTGTTTGAGCAATT
GATCCAGAATTTGGCAGATAATGATCCAAACCGATATGGGACTCCTCCGGCGTCGAGAGCAGCGGTGGAGGGGCTCTCTACCATTTTGTTGATGA
GGAATTGATGCGTTCTGAACTGGCACAGTGTGCTGTTTGTAAGGATGATTCTGAGATGGGGTCACGATGTGATACAGATGCCTTGTAAGCATGTT
TATCATAAGGATTGTCTCATACCGTGGCTTGAGTTGCACAGTTCTTGCCCGGTTTGTCGCTATGAGTTGCCAACGGATGAGCCTGAGAATGAGAA
CAGGCAAACAGACAATGATGGGGACTCGAGCGGTGATGGTTCTGCTTCTGGAAGTGGGGATCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E288154] SGN-U569746 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T98910 [Download] [View] Facility Assigned ID: TPSBA07TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0174 Quality Trim Threshold: 20.5